|
OriGene
slug cat no rc202365l1 expression Slug Cat No Rc202365l1 Expression, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/SLUG+(SNAI2)+(NM_003068)+Human+Tagged+ORF+Clone/pmc08657120-54-7-15 Average 90 stars, based on 1 article reviews
slug cat no rc202365l1 expression - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
snail2 expression constructs Snail2 Expression Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/SLUG+(SNAI2)+(NM_003068)+Human+Tagged+ORF+Clone/10__1523_slash_jneurosci__0370___14__2014-56-3-9 Average 90 stars, based on 1 article reviews
snail2 expression constructs - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
snai2 cdna expressing plasmid ![]() Snai2 Cdna Expressing Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/SLUG+(SNAI2)+(NM_003068)+Human+Tagged+ORF+Clone/pm35864202-364-0-7 Average 90 stars, based on 1 article reviews
snai2 cdna expressing plasmid - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
martin cheung ![]() Martin Cheung, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/pCIG-V5-Snail2-IRES-nls-GFP+(Plasmid+%2344282)/pmc11322362-103-17-19 Average 91 stars, based on 1 article reviews
martin cheung - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
OriGene
human slug cloning vector ![]() Human Slug Cloning Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/SLUG+(SNAI2)+(NM_003068)+Human+Untagged+Clone/pmc04097240-127-1-8 Average 90 stars, based on 1 article reviews
human slug cloning vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Sino Biological
snail2 ![]() Snail2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/Human+SNAI2+%2F+Snail2+%2F+slug+Gene+ORF+cDNA+clone+in+cloning+vector/pmc08645768-65-1-12 Average 91 stars, based on 1 article reviews
snail2 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Sino Biological
g118126 slug gfp sinobiological inc ![]() G118126 Slug Gfp Sinobiological Inc, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/Human+SNAI2+%2F+Snail2+%2F+slug+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-GFPSpark+tag/pm37342906-532-66-68 Average 91 stars, based on 1 article reviews
g118126 slug gfp sinobiological inc - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Boster Bio
snai2 ![]() Snai2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/Anti-Slug+SNAI2+Antibody/pmc04827396-249-25-34 Average 90 stars, based on 1 article reviews
snai2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
snail2 f: ctggtcaagaagcatttcaacgcc r: atgggttaccggagagaggagaaa ![]() Snail2 F: Ctggtcaagaagcatttcaacgcc R: Atgggttaccggagagaggagaaa, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/snail2+f++ctggtcaagaagcatttcaacgcc+r++atgggttaccggagagaggagaaa/pmc08877073-50-0-6 Average 90 stars, based on 1 article reviews
snail2 f: ctggtcaagaagcatttcaacgcc r: atgggttaccggagagaggagaaa - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Promega
snail2 reporter construct ![]() Snail2 Reporter Construct, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/snail2+reporter+construct/10__1111_slash_j__1440___169x__2010__01187__x-57-1-10 Average 90 stars, based on 1 article reviews
snail2 reporter construct - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Abnova
snail 2 ![]() Snail 2, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/snail+2/snail+2/pmc05497804-10-0-7 Average 90 stars, based on 1 article reviews
snail 2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific reports
Article Title: PARP1-SNAI2 transcription axis drives resistance to PARP inhibitor, Talazoparib.
doi: 10.1038/s41598-022-16623-3
Figure Lengend Snippet: Figure 2. Cell line-dependent reversibility of acquired Talazoparib resistance. (a) Immunoblot showing PAR level of PSN1 parental cells, TalaR cells maintained in media with Talazoparib (TalaR-M) and TalaR cells cultured in drug-free media for 4 weeks (TalaR-DF). (b) Talazoparib IC50 chart showing reversibility of acquired resistance in PSN1 cells over 4 weeks after drug withdrawal. (c–f) Clonogenic assay showing Talazoparib sensitivity of parental and acquired resistant cells in PSN1, PANC1, SW1990 and HCC1806 cells which were maintained in drug media (Tala-M) and in drug free media for 4 weeks (Tala-DF). (g, h) Volcano plots showing differentially expressed genes between TalaR-M and TalaR-DF in PSN1 and HCC1806 cells. (i, j) UMAP representations of HCC1806 parental and resistant subpools, colored by cell line (i) or cluster identity (j). (k, l) Violin plots of SNAI2 (k) and TWIST1 (l) gene expression profile across subpopulation clusters shown in (j).
Article Snippet:
Techniques: Western Blot, Cell Culture, Clonogenic Assay, Gene Expression
Journal: Scientific reports
Article Title: PARP1-SNAI2 transcription axis drives resistance to PARP inhibitor, Talazoparib.
doi: 10.1038/s41598-022-16623-3
Figure Lengend Snippet: Figure 5. CHD1L depletion re-sensitizes cells with acquired resistance to Talazoparib. (a) Clonogenic assay showing growth of PSN1 TalaR-M cells with CHD1L stable knockdown. (b) Immunoblot showing expression level of CHD1L and SNAI2 in CHD1L stable knockdown cells as in (a). (c) IncuCyte curves showing the growth PSN1 TalaR-M with inducible CHD1L knockdown with and without doxycycline induction. (d) qPCR showing mRNA level of CHD1L and SNAI2 in PSN1 TalaR-M with inducible CHD1L knockdown with and without doxycycline induction as in (c). (e) IncuCyte curves showing the growth of PSN1 parental and TalaR-M with CHD1L knockout. (f) IncuCyte curves showing the growth of HCC1806 parental and TalaR-M with CHD1L knockout. (g, h) Immunoblot and qPCR showing CHD1L and SNAI2 level in HCC1806 parental and TalaR-M with CHD1L knockout as in (f).
Article Snippet:
Techniques: Clonogenic Assay, Knockdown, Western Blot, Expressing, Knock-Out
Journal: Cancer Science
Article Title: SNAIL2 contributes to tumorigenicity and chemotherapy resistance in pancreatic cancer by regulating IGFBP2
doi: 10.1111/cas.15162
Figure Lengend Snippet: SNAIL2 is highly expressed in tumorigenic pancreatic cancer cell lines. A, Microscopy images of 2D cultures and spheres (3D culture, day 7) in KLM1 and KMP5. Scale bars: 100 µm. B, qRT‐PCR (EMT‐TF) of KLM1 and KMP5. Relative expression levels normalized by HPDE cells were compared. n = 3, each. ND, not detected. Mean + SE. ** P < .01. C, qRT‐PCR ( SNAI2 ) of control vector versus shSNAI2 from KLM1 and KMP5. n = 3, each. Mean + SE. ** P < .01. D, Western blot (SNAIL2, CDH1, VIM, and ACTB) of control vector versus shSNAI2 from KLM1 and KMP5. The relative intensity (ratio) is shown below each band. shRNA was used shSNAI2_1
Article Snippet: The
Techniques: Microscopy, Quantitative RT-PCR, Expressing, Plasmid Preparation, Western Blot, shRNA
Journal: Cancer Science
Article Title: SNAIL2 contributes to tumorigenicity and chemotherapy resistance in pancreatic cancer by regulating IGFBP2
doi: 10.1111/cas.15162
Figure Lengend Snippet: SNAI2 is highly expressed in spheroids established from surgically resected human pancreatic cancer. A, Immunohistochemical SNAIL2 staining of human pancreatic cancer (2 samples). Scale bars: 100 µm. B, Microscope image of spheroids in 3D culture (left), H&E staining of spheroids (middle), H&E staining of primary tumor (right). Scale bars: 100 µm. C, qRT‐PCR (EMT‐TF) of Sphs. Relative expression levels normalized by HPDE cells were compared. n = 3. ND, not detected. Mean + SE. ** P < .01. D, Microscopic image of control vector and shSNAI2 from Sphs in 3D culture. Scale bars: 100 µm. E, qRT‐PCR ( SNAI2 ) of control vector versus shSNAI2 from spheroids. n = 3, each. Mean + SE. * P < .05, ** P < .01. F, Western blot (SNAIL2, CDH1, VIM, and ACTB) of control vector versus shSNAI2 from Sph. shRNA was used shSNAI2_1. The relative intensity (ratio) is shown below each band
Article Snippet: The
Techniques: Immunohistochemical staining, Staining, Microscopy, Quantitative RT-PCR, Expressing, Plasmid Preparation, Western Blot, shRNA
Journal: Cancer Science
Article Title: SNAIL2 contributes to tumorigenicity and chemotherapy resistance in pancreatic cancer by regulating IGFBP2
doi: 10.1111/cas.15162
Figure Lengend Snippet: Gene transduction of IGFBP2 and SNAI2 into shSNAI2 restores mRNA and protein expression and improves tumorigenicity and resistance to gemcitabine. A, qRT‐PCR ( SNAI2 and IGFBP2 ) in sh+Vector, sh+IGFBP2 and sh+SNAI2 from KLM1. n = 3, each. Mean + SE. ** P < .01. B, Western blot (SNAIL2, IGFBP2, and ACTB) of sh+Vector versus sh+IGFBP2 and sh+SNAI2 from KLM1 cells. The relative intensity (ratio) is shown below each band. C, D, Sphere formation assay of parental cells, sh+Vector, sh+IGFBP2 and sh+SNAI2 from KLM1 cell at day 7. C, Microscope images. Scale bars: 100 µm. D, Quantification of the number of spheres. n = 3, each. Mean + SE. ** P < .01. E‐H, sh+Vector, sh+IGFBP2, and sh+SNAI2 cells from KLM1 cells were subcutaneously transplanted into NOD‐SCID mice (10 5 cells, 10 4 cells per site), respectively. n = 3. E, Macroscope images of the formed tumor. F, Number of tumor‐forming mice per total transplanted mice at 12 wk after transplantation. G, Tumor growth curves. Mean + SE. * P < .05, ** P < .01. H, H&E staining of the formed tumor. The mesenchymal area (indicated by arrows) ratio is shown below each picture. Scale bars: 100 µm. I, The relative viability of parent cells, sh+Vector versus sh+IGFBP2, and sh+SNAI2 from KLM1 cells 96 h after treatment with gemcitabine. Viability curves at 0, 1, 10, 100 ng/mL gemcitabine. n = 4, each. Mean + SE. ** P < .01
Article Snippet: The
Techniques: Transduction, Expressing, Quantitative RT-PCR, Plasmid Preparation, Western Blot, Tube Formation Assay, Microscopy, Transplantation Assay, Staining
Journal: Scientific Reports
Article Title: TALENs-directed knockout of the full-length transcription factor Nrf1α that represses malignant behaviour of human hepatocellular carcinoma (HepG2) cells
doi: 10.1038/srep23775
Figure Lengend Snippet: All pairs of F/R primers used for real-time qPCR.
Article Snippet: Rabbit polyclonal antibodies against MMP9, SNAI1, p16 and Vimentin were bought from BioSynthesis (Beijing, China), whilst other rabbit antibodies against α-Catenin, CDK2, CDK6, Cyclin D1,
Techniques:
Journal: Cancer Science
Article Title: Pathological features of triple‐negative breast cancers that showed progressive disease during neoadjuvant chemotherapy
doi: 10.1111/cas.13274
Figure Lengend Snippet: Dendrogram and heat map of the unsupervised hierarchical cluster analysis for 11 molecules in 102 triple‐negative breast cancers. Two clusters ( A and B ) and seven subclusters ( a – g ) are identified. According to the criteria described in Materials and Methods, for ZEB 1, TWISTNB , CK 5/6, EGFR , AR , vimentin, HGMB 1, and Snail‐2 expressions, positive cases are indicated in red whereas negative cases are indicated in green. For E‐cadherin ( CDH 1) and BRCA 1, cases with loss of expression are indicated in red whereas cases with expression are indicated in green. For proliferation, cases with high proliferation, defined as >50 mitotic counts per 10 high power fields or >50% Ki‐67 labeling index, are indicated in red, and otherwise the cases are indicated in green. As special histological types, metaplastic carcinomas are colored in pale pink, and apocrine carcinoma and pleomorphic lobular carcinoma are colored in orange. Cases that showed cPD and recurrence are also indicated in yellow and dense pink, respectively. UK , unknown; contra, metachronous contralateral breast.
Article Snippet:
Techniques: Expressing, Labeling